View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16141_high_24 (Length: 253)
Name: NF16141_high_24
Description: NF16141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16141_high_24 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 253
Target Start/End: Complemental strand, 11177733 - 11177495
Alignment:
| Q |
13 |
aaatgaatgggcttttcaatgattatagaattagttaatttagttcacagtgtctttgtcgatttagatttctttttgtagttttggtatgtggtagttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11177733 |
aaatgaatgggcttttcaatgattatagaattagccaatttagttta--gtgtctttgtcgatttagatttctttttctagttttggtatgtggtagttt |
11177636 |
T |
 |
| Q |
113 |
gatacaagtatatgagtatgaagctttataattaagttgaaatttatttattattgttggattgattcaaagaaattttttattcctccacccagaacat |
212 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11177635 |
gatacaagtttatgagtatgaagctttataattaagttgaaatttatttattattgttggattgattcaaagaaattttttattcctccacccacaacat |
11177536 |
T |
 |
| Q |
213 |
taacactaaatctttctcttgattttatattgattctgtat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11177535 |
taacactaaatctttctcttgattttatattgattctgtat |
11177495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 218 - 252
Target Start/End: Complemental strand, 11184768 - 11184734
Alignment:
| Q |
218 |
ctaaatctttctcttgattttatattgattctgta |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11184768 |
ctaaatctttctcttgattttatattgattctgta |
11184734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University