View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16141_low_17 (Length: 305)
Name: NF16141_low_17
Description: NF16141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16141_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 23 - 298
Target Start/End: Complemental strand, 19127827 - 19127550
Alignment:
| Q |
23 |
atctaaaaacacaaacaagaagaaccacaacaagaataaggagaagaagaaggttaaggagtcgcgtcattcaccaccccatcatgacaatgttatcaat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19127827 |
atctaaaaacacaaacaagaagaaccacaacaagaataaggagaagaagaaggttaaggagtcgcgtcattcaccaccccatcatgacaatgttatcaat |
19127728 |
T |
 |
| Q |
123 |
gattcctcgattttcacatgtgcacaccgacgcatgaaacaaaggtggcctttgactcttgcagtctcgcttcaatcacatgtttacatactgtag-nnn |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19127727 |
gattcctcgattttcacatgtgcacaccgatgcatgaaacaaaggtggcctttgactcttgcagtctcgcttcaaccacatgtttacatactgtagtttt |
19127628 |
T |
 |
| Q |
222 |
nnnnngcctagttctgtttccatcgac--aagagaggcgagcccaaggataacctaacctcaaaacctgatattcttcg |
298 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
19127627 |
tttttgcctagttctgtttccatcgacaaaagagaggcgagcccaaggataa-ctaacctcaaaacctgattttcttcg |
19127550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University