View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16141_low_18 (Length: 303)
Name: NF16141_low_18
Description: NF16141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16141_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 38489610 - 38489395
Alignment:
| Q |
18 |
aaaggttatgttgtcagcttgaatattttctttgttgcatacctcgcnnnnnnnccagttgttgattggtttgtattgttaagtgctaactggtaaaggc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| ||| ||||||||||||||||||||||| |
|
|
| T |
38489610 |
aaaggttatgttgtcagcttgaatattttctttgttgcatacctcgctttttttccagttgttgattgttttatatggttaagtgctaactggtaaaggc |
38489511 |
T |
|
| Q |
118 |
ttgcttgaaacaaattaattgtatataatgtctcataagaattttcatagttgttggatggtttataaggccttttactgctaaaacccttatgttaagt |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38489510 |
ttgcttgaaacaaattaattggatataatgtctcataagaattttcatagttgttggatggtttataaggccttttactgctaaaacccttatgttaagt |
38489411 |
T |
|
| Q |
218 |
gcgtacttgagctttt |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38489410 |
gcgtacttgagctttt |
38489395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 293
Target Start/End: Complemental strand, 38489338 - 38489294
Alignment:
| Q |
249 |
tgtgtcaacaatgccatttttctcaattttcttttggcattcatc |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38489338 |
tgtgtcaacaatgccatttttctcaattttcttttggcattcatc |
38489294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 110 - 242
Target Start/End: Original strand, 48446876 - 48447008
Alignment:
| Q |
110 |
gtaaaggcttgcttgaaacaaattaattgtatataatgtctcataagaattttcatagttgttggatggtttataaggccttttactgctaaaaccctta |
209 |
Q |
| |
|
||||||||||||||||| ||| ||||||| ||| |||||| ||||||||||||| || | ||||||||||||| | |||||||||||||||| ||||| |
|
|
| T |
48446876 |
gtaaaggcttgcttgaatcaatttaattggatactatgtcttataagaattttcaaagcttttggatggtttattaatccttttactgctaaaagcctta |
48446975 |
T |
|
| Q |
210 |
tgttaagtgcgtacttgagcttttgctagcaac |
242 |
Q |
| |
|
||||||||| ||| ||||| | || |||||||| |
|
|
| T |
48446976 |
tgttaagtgggtaattgagttctttctagcaac |
48447008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University