View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16141_low_27 (Length: 247)
Name: NF16141_low_27
Description: NF16141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16141_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 34617317 - 34617151
Alignment:
| Q |
64 |
tgattacatacgtgtgaattgacaaactataggcattctttattaatcaccttatttttaattatgaatcaaatgagtttactttgctttgtcaaacata |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34617317 |
tgattacatacgtgtgaattgacaaactataggcatcctttattaatcaccttatttttaattatgaatcaaatgagtttactttgctttgtcaaacata |
34617218 |
T |
 |
| Q |
164 |
aacaaactacatgttgaagaagctagaatgactaacatacacaatgataatcaagccagtccgatat |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34617217 |
aacaaactacatgttgaagaagctagaatgactaacatacacaatgataatcaagccagtccgatat |
34617151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University