View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16141_low_30 (Length: 223)
Name: NF16141_low_30
Description: NF16141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16141_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 36065472 - 36065282
Alignment:
| Q |
18 |
gtccaagaccaagtgacctgcaaatttctcatccggttcaaccgggtctggttcggttttcttgagggagagtcttgttgtagtttttgaaactggccat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36065472 |
gtccaagaccaagtgacctgcaaatttctcatccggttcaaccgggtctggttcggttttcttgagggagagtcttgttgtagtttttgaaactggccat |
36065373 |
T |
 |
| Q |
118 |
gcatggttgtggtcggaggagtaggttatgatgagcattgtggggtccacacggcttctttctacttgtttccttgctggacaacctttgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36065372 |
gcatggttgtggtcggaggagtaggttatgatgagcattgtggggtccacacggcttctttctacttgtttccttgctggacaacctttgc |
36065282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 138 - 206
Target Start/End: Original strand, 35202732 - 35202800
Alignment:
| Q |
138 |
gtaggttatgatgagcattgtggggtccacacggcttctttctacttgtttccttgctggacaaccttt |
206 |
Q |
| |
|
|||||||| || ||| ||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
35202732 |
gtaggttacgaggaggtttgtggggtccacacggcttctttcgacttgttttcttgctggacaaccttt |
35202800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University