View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16142_low_6 (Length: 267)
Name: NF16142_low_6
Description: NF16142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16142_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 4094214 - 4094409
Alignment:
| Q |
1 |
ataccggaatgaaagattccaaagccaaagagataaagataattattgattggagtaagatcatatacattgagatacaccatagcacgagaagcattct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4094214 |
ataccggaatgaaagattccaaagccaaagagataaagataattattgattggagtaagatcatatacattgagatacaccatagcacgagaagtattct |
4094313 |
T |
|
| Q |
101 |
gagtgttccggtggtccctttcggagcttgtactcaattgaaaccaccgcattgtccaattatgaatcaaagtttcat---ttatgttatgcagtg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
4094314 |
gagtgttccggtggtccctttcggagcttgtactcaattgaaaccaccgcattgtccaattatgaatcacagtttcattaattatgttatgcagtg |
4094409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University