View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16142_low_8 (Length: 221)
Name: NF16142_low_8
Description: NF16142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16142_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 47527724 - 47527520
Alignment:
| Q |
1 |
catcgtctgatgatccacttgttgttgacttgattgtaacagctggtttctttggcatgcaaggaaccccaacagcaactttgatatctttattttgtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47527724 |
catcgtctgatgatccacttgttgttgacttgattgtaacagctggtttctttggcatgcaaggaaccccaacagcaactttgatatctttattttgtaa |
47527625 |
T |
|
| Q |
101 |
tttagatggatcatttccagaagggccacattctacataggaatcaaatacaaaagacatatgtttttacatatgcaaacatgaactttataaacacata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
47527624 |
tttagatggatcatttccagaagggccacattctacataggaatcaaatacaaaagacatatgtttttacatatgcagacatgaacttaataaacacata |
47527525 |
T |
|
| Q |
201 |
aaaat |
205 |
Q |
| |
|
|||| |
|
|
| T |
47527524 |
caaat |
47527520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 86 - 137
Target Start/End: Original strand, 10266856 - 10266907
Alignment:
| Q |
86 |
atctttattttgtaatttagatggatcatttccagaagggccacattctaca |
137 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
10266856 |
atctttattttgtaatttaaatggattatttccagaagggccacattctaca |
10266907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University