View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16143_high_10 (Length: 325)
Name: NF16143_high_10
Description: NF16143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16143_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 47328665 - 47328905
Alignment:
| Q |
1 |
gtaatagtatctcaaaattggcttgtatcttttccatcgacaaaagctacatgatctctatgatcgcaaagtttggtgtgatgttactcttatggatgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47328665 |
gtaatagtatctcaaaattggcttgtatcttttccatcgacaaaagctatatgatctctatgatcgcaaagtttggtgtgatgttactcttatggatgtt |
47328764 |
T |
 |
| Q |
101 |
tgccaccnnnnnnnngg-aagaccttggcaatatgatctccatgccttat--gacagtcatgccaatactcacatttaagtgaaagatcaagttaaaatc |
197 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47328765 |
tgccacctttttttttgtaagaccttggcaatatgatctccatgccttatacgacagtcatgcgaatactcacatttaagtgaaagatcaagttaaaatc |
47328864 |
T |
 |
| Q |
198 |
gagttggtacctctacaacccggtgaactcaatgaaggaag |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47328865 |
gagttggtacctctacaacccggtgaactcaatgaaggaag |
47328905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 260 - 304
Target Start/End: Original strand, 47328935 - 47328979
Alignment:
| Q |
260 |
caagtcattagaacttatagtcaacaaagttatttatgccatgtg |
304 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47328935 |
caagtcactagaacttatagtcaacaaagttatatatgccatgtg |
47328979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University