View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16143_high_13 (Length: 279)
Name: NF16143_high_13
Description: NF16143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16143_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 14 - 262
Target Start/End: Complemental strand, 34847388 - 34847140
Alignment:
| Q |
14 |
atatataccgcataccatacaaagaacacaagatgtagcgaagattaaaccaaatcattgctactattctattaaattacattagtccttatttcatttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34847388 |
atatataccgcataccatacaaagaacacaagatgtagcgaagattaaaccaaatcattgctactattctattaaattacattagtccttatttcatttt |
34847289 |
T |
|
| Q |
114 |
gaattttgccatgagacaataagtatatattgatatatgcttatgcttctagattgtcaactttcgacatgcaacttgcacacggttagaagaatttata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34847288 |
gaattttgccatgagacaataagtatatattgatatatgcttatgcttctagattgtcaactttcgacatgcaacttgcacacggttagaagaatttata |
34847189 |
T |
|
| Q |
214 |
gttatgtatgtctatcgtttgtcccactagttaatgtctagaatctaat |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34847188 |
gttatgtatgtctatcgtttgtcccactagttaatgtctagaatctaat |
34847140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University