View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16143_low_18 (Length: 266)
Name: NF16143_low_18
Description: NF16143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16143_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 19 - 257
Target Start/End: Original strand, 5274033 - 5274271
Alignment:
| Q |
19 |
attcagctaagcctgatgatagaagcaagtcatcatcagcaaaggatgacgatgatgagaataatgacttgcctgcagaagcttctggtgctggttattc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5274033 |
attcagctaagcctgatgatagaagcaagtcatcatcagcaaaggatgacgatgatgagaataatgacttgcctgcagaagcttctggtgctggttattc |
5274132 |
T |
|
| Q |
119 |
taatgtggatggaatgtggctggctcttgtttttgggatggttttgcttgctggtgaagcaatgctatgaatttgatgatttgatttggtaatattaatt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5274133 |
aaatgtggatggaatgtggctggctcttgtttttgggatggttttgcttgctggtgaagcaatgctatgaatttgatgatttgatttggtaatattaatt |
5274232 |
T |
|
| Q |
219 |
ttgttgtgcgctgtttcaggtcatgtgagtcattcatat |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5274233 |
ttgttgtgcgctgtttcaggtcatgtgagtcattcatat |
5274271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University