View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16143_low_23 (Length: 205)
Name: NF16143_low_23
Description: NF16143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16143_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 43843329 - 43843154
Alignment:
| Q |
17 |
cagattgtgcattttggttcataattgttccttttctaaccatcaaagattacaacataaatttagtaagtactactatcatttacttattgtctaatgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
43843329 |
cagattgtgcattttggttcataattgttccttttctaaccatcaaagattacaacataaatttagtaagtactgctatcatttacttattgtctcatgg |
43843230 |
T |
|
| Q |
117 |
atattttatgtctttttcttaataactttgacttagataagttatattctatgcttgttttaataatcagtattat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43843229 |
atattttatgtctttttcttaataactttgacttagataagttatattctatgcttgttttaataatcagtgttat |
43843154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 88
Target Start/End: Complemental strand, 34893317 - 34893248
Alignment:
| Q |
19 |
gattgtgcattttggttcataattgttccttttctaaccatcaaagattacaacataaatttagtaagta |
88 |
Q |
| |
|
||||||| ||||||||| || ||||||| ||||||||||||||||||||||| |||| || ||||||| |
|
|
| T |
34893317 |
gattgtgtattttggtttgtatttgttccatttctaaccatcaaagattacaatctaaactttgtaagta |
34893248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University