View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16143_low_7 (Length: 448)
Name: NF16143_low_7
Description: NF16143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16143_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 184 - 335
Target Start/End: Complemental strand, 11585407 - 11585256
Alignment:
| Q |
184 |
ttggaaactatattgtagttttttacttaacacaagtacatattatttagattgatgagtaacacgctaattaatattagcaaggaagagcaaacaatta |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11585407 |
ttggaaactatattgtagttttttacttaacataagtacatattatttagattgatgagtaacacgctaattaatcttagcaaggaagagcaaacaatta |
11585308 |
T |
|
| Q |
284 |
tttaaataccttatgttgtggttgtaattcttagaaatttaacaatgttgtg |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11585307 |
tttaaataccttatgttgtggttgtaattcttagaaatttaacaatgttgtg |
11585256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 382 - 436
Target Start/End: Complemental strand, 11585210 - 11585156
Alignment:
| Q |
382 |
gggacgccgaggttcaaacatgggaaatatatttaacaatttggttaccctttgc |
436 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11585210 |
gggacgccgaggttcaaacatgggaagtatatttaacaatttggttaccctttgc |
11585156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University