View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16145_low_7 (Length: 201)
Name: NF16145_low_7
Description: NF16145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16145_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 12 - 185
Target Start/End: Original strand, 36884407 - 36884580
Alignment:
| Q |
12 |
agattatactttgccctcaggaaatacagctttgtaaacgggaccaagagatccctctcccagaaggttgccttcattaaagaagttagtagccagctga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36884407 |
agattatactttgccctcaggaaatacagctttgtaaacgggaccaagagatccctctcccagaaggttgccttcattaaagaagttagtagccagctga |
36884506 |
T |
|
| Q |
112 |
agctctgctatggtataaattttcgtccttccagtggatctgcctcttttggaaaaacttcttcttgatgtttc |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36884507 |
agctctgctatggtataaattttcgtccttccagtggatctgcctcttttggaaaaacttcttcttgatgtttc |
36884580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 178
Target Start/End: Original strand, 22554762 - 22554902
Alignment:
| Q |
38 |
cagctttgtaaacgggaccaagagatccctctcccagaaggttgccttcattaaagaagttagtagccagctgaagctctgctatggtataaattttcgt |
137 |
Q |
| |
|
||||| ||||||| || |||||||| || |||||||||||||| ||||| | || ||||||| ||| ||||| ||| |||| || |||| ||||| |
|
|
| T |
22554762 |
cagctctgtaaacagggccaagagagcctactcccagaaggttgtcttcactgaaattgttagtaaccaactgaacctcagctactgtgtaaaccttcgt |
22554861 |
T |
|
| Q |
138 |
ccttccagtggatctgcctcttttggaaaaacttcttcttg |
178 |
Q |
| |
|
||||| ||| || || |||||| |||||||||||||||| |
|
|
| T |
22554862 |
ccttctggtgtatttgtctctttcagaaaaacttcttcttg |
22554902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University