View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16146_low_17 (Length: 226)
Name: NF16146_low_17
Description: NF16146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16146_low_17 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 58 - 226
Target Start/End: Complemental strand, 13214217 - 13214049
Alignment:
| Q |
58 |
tttgtgaagaaggtttgaacatttttaagtaggaagaaagtgatcttttgcacgggatatagctgaactttgaagcataccaattctaggaaccatcaga |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13214217 |
tttgtgaagaaggtttgaacatttttaagtaggaagaaagtgatcttttgcacgggatatagctgaactttgaagcataccaattctaggaaccatcaga |
13214118 |
T |
 |
| Q |
158 |
ggaagcaataatgagttccaaagacatagagatagaggtggttgtctgaaaagaaggtgcatatagctg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13214117 |
ggaagcaataatgagttccaaagacatagagatagaggtggttgtctgaaaagaaggtgcatatagctg |
13214049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 45
Target Start/End: Complemental strand, 13214268 - 13214233
Alignment:
| Q |
10 |
attatactaaaaacacaggaaggtttgatcattaag |
45 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13214268 |
attatactaaaaacacaggaaggtttgaacattaag |
13214233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University