View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16146_low_8 (Length: 321)
Name: NF16146_low_8
Description: NF16146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16146_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 8e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 27 - 135
Target Start/End: Complemental strand, 4686705 - 4686597
Alignment:
| Q |
27 |
aaagtgattatggtgatgggagagatgcgcaagtctttcaaggattctcttaaagctcttgaagctgatattcaatttgccaatacactgtaaaatttct |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4686705 |
aaagtgattatggtgatgggagagatgcgcaagtctttcaaggattctcttaaagctcttgaagctgatattcaatttgccaatacactgtaaaatttct |
4686606 |
T |
 |
| Q |
127 |
tgaattccc |
135 |
Q |
| |
|
||||||||| |
|
|
| T |
4686605 |
tgaattccc |
4686597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 246 - 302
Target Start/End: Complemental strand, 4686490 - 4686434
Alignment:
| Q |
246 |
atgattgctgaaatatggagtaatctgtgttctgtttgttcatattcaaggtagtgt |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4686490 |
atgattgctgaaatatggagtaatctgtgttctgtttgttcatattcaaggtagtgt |
4686434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 9e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 51 - 119
Target Start/End: Complemental strand, 24968493 - 24968425
Alignment:
| Q |
51 |
atgcgcaagtctttcaaggattctcttaaagctcttgaagctgatattcaatttgccaatacactgtaa |
119 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24968493 |
atgcgaaagtctttcaaggattctctcaaagctcttgaagctgatattcaatttgctaatacactgtaa |
24968425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University