View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16146_low_9 (Length: 309)
Name: NF16146_low_9
Description: NF16146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16146_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 85 - 189
Target Start/End: Complemental strand, 17819878 - 17819772
Alignment:
| Q |
85 |
gtgttactgtgatttcatcaaactcacctgtcattcgagaatacaca--acctatatactaaatatttgctcctacattcaaactaggaacactactgca |
182 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||| ||| |||||| |||| ||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17819878 |
gtgttactgtgatttcatcaaactcacccgtcatttgagaatatacataacctatgtactgaatctttgctcctacattcaaactaggtacactactgca |
17819779 |
T |
 |
| Q |
183 |
tttacgc |
189 |
Q |
| |
|
||||||| |
|
|
| T |
17819778 |
tttacgc |
17819772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University