View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16148_low_5 (Length: 202)
Name: NF16148_low_5
Description: NF16148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16148_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 7e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 13 - 126
Target Start/End: Original strand, 20399556 - 20399669
Alignment:
| Q |
13 |
ataattctcaattgataatatagtatgctttaattcaatatcaatagacctaaatcttcaaccattccgcatgaaacaaaacgtacacggcaggacttca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
20399556 |
ataattctcaattgataatatagtatgctttaattcactatcaatagacctaaatcttcaaccatttcgcatgaaacaaaacgtacacggcaggacatca |
20399655 |
T |
|
| Q |
113 |
tgaacaataacatt |
126 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
20399656 |
tgaacaataacatt |
20399669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University