View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16149_high_31 (Length: 268)
Name: NF16149_high_31
Description: NF16149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16149_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 13 - 252
Target Start/End: Original strand, 23761817 - 23762056
Alignment:
| Q |
13 |
aatataggtctggataattaccttttgacatagatatcatgttcactgatgcacttttcaaaattcagttcttgtcaattctcgtattttatttcatgtt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23761817 |
aatataggtctggataattaccttttgacatagatatcatgttcactgatgcacttttcaaaattcagttgttgtcaattctcgtattttatttcatgtt |
23761916 |
T |
|
| Q |
113 |
cttgtgcctattttagaccatataaagcgtttctcaatatgtaaactttgtcctcttgacctgttatttcatatcatgggttttgcttcacaaatacttc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23761917 |
cttgtgcctattttagaccatataaagcgtttctcaatatgtaaactttgtcttcttgacctgttatttcatatcatgggttttgcttcacaaatgcttc |
23762016 |
T |
|
| Q |
213 |
atccaatggcccattaaagaatgcagtttttataccaagt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23762017 |
atccaatggcccattaaagaatgcagtttttataccaagt |
23762056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University