View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16149_high_38 (Length: 228)
Name: NF16149_high_38
Description: NF16149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16149_high_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 41863980 - 41864170
Alignment:
| Q |
18 |
ctaccggcactacctttgctactggcaccaccactgctgtgaaatgccaaggaagaaataggagggagcacaagagaaacaacatgttccagaggatgaa |
117 |
Q |
| |
|
|||| ||||| |||||||||||| ||| |||||| || || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41863980 |
ctactggcaccacctttgctactagcaacaccacggc---gacatgccaaggaagaaataggagggagcacaagagaaacaacatgttccagaggatgaa |
41864076 |
T |
 |
| Q |
118 |
ggatggcgtatccggtcacaacagtgacagtggcagtagcagtgatgagagtgacagcgacaatgaaaattgtcgcaacaggaaggcaagtata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41864077 |
ggatggcgtatccggtcacaacagtgacagtggcagtagcagtgatgagagtgacagcgacaatgaaaattgtcgcaacaggaaggcaagtata |
41864170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University