View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16149_high_40 (Length: 224)

Name: NF16149_high_40
Description: NF16149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16149_high_40
NF16149_high_40
[»] chr3 (4 HSPs)
chr3 (14-210)||(16023902-16024098)
chr3 (87-180)||(5155253-5155346)
chr3 (139-203)||(46478252-46478316)
chr3 (44-197)||(4582491-4582644)
[»] chr2 (3 HSPs)
chr2 (46-188)||(20143496-20143638)
chr2 (118-188)||(20169944-20170014)
chr2 (90-188)||(20154401-20154499)
[»] chr8 (1 HSPs)
chr8 (46-204)||(9677631-9677789)
[»] chr4 (1 HSPs)
chr4 (88-206)||(35160478-35160596)


Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 14 - 210
Target Start/End: Complemental strand, 16024098 - 16023902
Alignment:
14 cagagagggtgatggaaacgagtttagccacaaaggagttgagattattggtagattcggagcgtaggaaatggagaagctgttgttgtgtcggtcccac 113  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |    
16024098 cagagagggttatggaaacgagtttagccacaaaggagttgagattattggtagattcggagcggaggaagtggagaagctgttgttgtgtcggtccctc 16023999  T
114 ggatccagcagcgataaggctgagaacaacttgaagtgatagcggagaaaacacgatgttattgtctgattgttttgaaaagagttgtttgacgatg 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||    
16023998 ggatccagcagcgataaggctgagaacaacttgaagtgatagcggagaaaacatgatgttattgtctgattgttttgaaaagagatgtttgacgatg 16023902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 87 - 180
Target Start/End: Complemental strand, 5155346 - 5155253
Alignment:
87 gagaagctgttgttgtgtcggtcccacggatccagcagcgataaggctgagaacaacttgaagtgatagcggagaaaacacgatgttattgtct 180  Q
    |||||||||||||||||| || ||| | || ||||||||||| | ||| || ||||||||||| || || || |||||||| ||||| ||||||    
5155346 gagaagctgttgttgtgtgggaccctcagagccagcagcgatgatgcttagtacaacttgaagagacagtggcgaaaacacaatgttcttgtct 5155253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 203
Target Start/End: Complemental strand, 46478316 - 46478252
Alignment:
139 acaacttgaagtgatagcggagaaaacacgatgttattgtctgattgttttgaaaagagttgttt 203  Q
    |||||||| ||||| || ||||||||||||||||| |||||||||| ||| || ||||| |||||    
46478316 acaacttggagtgaaagtggagaaaacacgatgttgttgtctgattctttggagaagagatgttt 46478252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 44 - 197
Target Start/End: Original strand, 4582491 - 4582644
Alignment:
44 caaaggagttgagattattggtagattcggagcgtaggaaatggagaagctgttgttgtgtcggtcccacggatccagcagcgataaggctgagaacaac 143  Q
    ||||||||||||||| ||  || |||| |||| | ||||| | ||||||||||| |  ||| |||||  | || ||||||||||| | ||||||  ||||    
4582491 caaaggagttgagatgatcagttgatttggagagaaggaagtcgagaagctgttctcttgtgggtccgtcagagccagcagcgatcatgctgagcgcaac 4582590  T
144 ttgaagtgatagcggagaaaacacgatgttattgtctgattgttttgaaaagag 197  Q
    ||| || || || || |||||||| ||||| || ||||||| |||||| |||||    
4582591 ttggagcgaaagtggggaaaacacaatgttcttctctgattcttttgagaagag 4582644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 46 - 188
Target Start/End: Complemental strand, 20143638 - 20143496
Alignment:
46 aaggagttgagattattggtagattcggagcgtaggaaatggagaagctgttgttgtgtcggtcccacggatccagcagcgataaggctgagaacaactt 145  Q
    |||||||| |||| |||||| |||| | |||| ||||| | || ||| ||||||||||| ||  |  | || |||||||||||||||||||| |||| ||    
20143638 aaggagttaagatgattggtggatttgaagcggaggaagtcgacaagttgttgttgtgtgggatcttcagaaccagcagcgataaggctgagcacaattt 20143539  T
146 gaagtgatagcggagaaaacacgatgttattgtctgattgttt 188  Q
    | |||||||| || |||||||||||||| ||||||||||||||    
20143538 ggagtgatagtggcgaaaacacgatgttcttgtctgattgttt 20143496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 118 - 188
Target Start/End: Original strand, 20169944 - 20170014
Alignment:
118 ccagcagcgataaggctgagaacaacttgaagtgatagcggagaaaacacgatgttattgtctgattgttt 188  Q
    |||| ||| ||||||||||| |||| |||||||||||| || |||||||||| ||| ||||||||||||||    
20169944 ccagtagcaataaggctgagcacaatttgaagtgatagtggtgaaaacacgacgtttttgtctgattgttt 20170014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 90 - 188
Target Start/End: Complemental strand, 20154499 - 20154401
Alignment:
90 aagctgttgttgtgtcggtcccacggatccagcagcgataaggctgagaacaacttgaagtgatagcggagaaaacacgatgttattgtctgattgttt 188  Q
    ||||||||||||||| || ||  | || ||||||||| | |||||||  |||||||| ||||| |  || |||||||| ||||| ||||||||||||||    
20154499 aagctgttgttgtgtgggaccttcagagccagcagcggtgaggctgaacacaacttggagtgacactggcgaaaacacaatgttcttgtctgattgttt 20154401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 46 - 204
Target Start/End: Original strand, 9677631 - 9677789
Alignment:
46 aaggagttgagattattggtagattcggagcgtaggaaatggagaagctgttgttgtgtcggtcccacggatccagcagcgataaggctgagaacaactt 145  Q
    ||||||||||||| || | | |||| | | || ||||| | ||||||||||||||| || || ||| | || ||||||||||| |  |||||||||||||    
9677631 aaggagttgagatgatcgatggatttgaaacggaggaagtcgagaagctgttgttgagtaggaccctcagagccagcagcgatgatactgagaacaactt 9677730  T
146 gaagtgatagcggagaaaacacgatgttattgtctgattgttttgaaaagagttgtttg 204  Q
    | || || |  || ||||| |||| ||| |||||||||| |||||| ||||| ||||||    
9677731 ggagagacaatggtgaaaagacgacgttgttgtctgattcttttgagaagagatgtttg 9677789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 88 - 206
Target Start/End: Complemental strand, 35160596 - 35160478
Alignment:
88 agaagctgttgttgtgtcggtcccacggatccagcagcgataaggctgagaacaacttgaagtgatagcggagaaaacacgatgttattgtctgattgtt 187  Q
    ||||||||||||||||| |  ||| | || ||||||| ||| | |||||| |||||||| || || |  || |||||||||||||| || ||||||| ||    
35160596 agaagctgttgttgtgttgaaccctcagagccagcagtgattatgctgagcacaacttggagagacaatggcgaaaacacgatgttcttttctgattctt 35160497  T
188 ttgaaaagagttgtttgac 206  Q
    | || ||||| ||||||||    
35160496 tggagaagagatgtttgac 35160478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University