View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16149_low_27 (Length: 326)
Name: NF16149_low_27
Description: NF16149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16149_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 19 - 296
Target Start/End: Original strand, 43280223 - 43280500
Alignment:
| Q |
19 |
cacaagcacctcaaattgtcgaaaatatcctgactaagagttaacggaatcgtttgctactttttaaatcggttaatcgagtaaccagtctaataagtat |
118 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||| |
|
|
| T |
43280223 |
cacaagcatctcaaattgtcgaaaatatcctgactaagagttaacggaatcgtttgctactttttaaatcggttaatcgagtaaccactctaaaacgtat |
43280322 |
T |
 |
| Q |
119 |
tatttttcttggcataccctgtgaggccacagttcaaaaagaaaatagttgtacaaacttttttgccaaaccaggagtttcttctagcattgatgttatg |
218 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43280323 |
catttttcttggcaaaccctgtgaggccaccgttcaaaaagaaaatagttgtacaaacttttttgccaaactaggagtttcttctagcattgatgttatg |
43280422 |
T |
 |
| Q |
219 |
atcgaccacttccctccattcgacatcttgaacctactttacgtagactatatggaaacttggtttcatagagctgaa |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43280423 |
atcgaccacttccctccattcgacatcttgaacctactttacgtagactatgtggaaacttggtttcatagagctgaa |
43280500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University