View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16149_low_33 (Length: 283)
Name: NF16149_low_33
Description: NF16149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16149_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 159 - 268
Target Start/End: Original strand, 7158984 - 7159094
Alignment:
| Q |
159 |
cgatttttattattttctaaattaatgtaccaatttctccaaaatgtagggtttatctct-aaaaaattggtgtatttggtctagtaatccatttattgt |
257 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7158984 |
cgatctttattattttctaaattaatgtaccaatttctccaaaatgtagggtttatctctaaaaaaattggtgtatttggtctagtaatccatttattgt |
7159083 |
T |
|
| Q |
258 |
agggtttatct |
268 |
Q |
| |
|
||||||||||| |
|
|
| T |
7159084 |
agggtttatct |
7159094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 237 - 267
Target Start/End: Original strand, 7158475 - 7158505
Alignment:
| Q |
237 |
gtctagtaatccatttattgtagggtttatc |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7158475 |
gtctagtaatccatttattgtagggtttatc |
7158505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University