View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16149_low_41 (Length: 244)
Name: NF16149_low_41
Description: NF16149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16149_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 215
Target Start/End: Complemental strand, 37976079 - 37975882
Alignment:
| Q |
18 |
agttaatacgttgtgccatgtcgccttcgcttggataaaatatcatattctatctcggatacacatacctattccaaaagaatgttgttcttgaaacaac |
117 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37976079 |
agttaatccgctgtgccatgtcgccttcgcttggataaaatatcctattctatctcggatacacatacctattccaaaagaatgttgttcttgaaacaac |
37975980 |
T |
 |
| Q |
118 |
gttgtatccacattgcattctaattctcctcattgactgtggtagccatcatgccagatgaactgatacgctgcatggtttctccatgtcctcccata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37975979 |
gttgtatccacattgcattctaattctcctcattgactgtggtagccatcatgccagatgaactgatacgctgcatggtttctccatgtcctcccata |
37975882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University