View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16149_low_8 (Length: 521)
Name: NF16149_low_8
Description: NF16149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16149_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 4e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 17 - 144
Target Start/End: Complemental strand, 56474140 - 56474013
Alignment:
| Q |
17 |
aaaatcaatagaaaaaactcaaacaaacacccaatttcaaattaaggggctagagagttgaaaaccaacatcaacaatcaaactcattctcttctaacca |
116 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||| |||||||||||| ||||| |||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
56474140 |
aaaatcaataaaaaaaactcaaacaaacatccacattcaaattaaggtgctagggagttgaaaaccaacatcaacaatcaaatttattctcttctaacca |
56474041 |
T |
 |
| Q |
117 |
aaaccaacatcataaacaagcacataac |
144 |
Q |
| |
|
|||||||||||| |||||||||| |||| |
|
|
| T |
56474040 |
aaaccaacatcacaaacaagcacctaac |
56474013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University