View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_high_102 (Length: 246)
Name: NF1614_high_102
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_high_102 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 11 - 228
Target Start/End: Original strand, 27523758 - 27523975
Alignment:
| Q |
11 |
tgaaatggactcgtacatgagttggttctggataaatcaaagtaaaaatacatacttcaatatgaatcagcaacaaagaataactatagtttattatgaa |
110 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
27523758 |
tgaaatggactcgtacatgacttggttctggttaaatcaaagtaaaaatacatacttcaatatgaatcagcaacaaagaataactatagtttattataaa |
27523857 |
T |
|
| Q |
111 |
gaatgtaactgataaagtatagaagttatattagatatatttactctgcgtgtacgaatgagtttgagggcagtatctaactgctgctccaaactctgaa |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
27523858 |
gaatgtaactgatcaagtatagaagttatattagatatatttactctgcgtgtacgaatgagtttgagagcagtatctaactgctgttccaaactctgaa |
27523957 |
T |
|
| Q |
211 |
gctctttgaggctcattg |
228 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
27523958 |
gctctttgaggctcattg |
27523975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University