View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_high_107 (Length: 241)
Name: NF1614_high_107
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_high_107 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 7e-64; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 6809022 - 6809145
Alignment:
| Q |
1 |
ttcgagccatgtggatgaaaaaaggtgatcgagagggaaaaacatactaaaggtgatcatattctccaacaaagatttgtcattgacaaagtaggtggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6809022 |
ttcgagccatgtggatgaaaaaaggtgatcgagagggaaaaacatactaaaggtgatcatattctccaacaaagatttgtcattgacaaagtaggtggat |
6809121 |
T |
|
| Q |
101 |
acttcatatcaataacatgattac |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6809122 |
acttcatatcaataacatgattac |
6809145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 157 - 224
Target Start/End: Original strand, 6809157 - 6809224
Alignment:
| Q |
157 |
gctagattcccataaaggagcatgcaacatgacaaattgctagtttgtgaaaatttctaaattatagg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6809157 |
gctagattcccataaaggagcatgcaacatgacaaattgctagtttgtgaaaatttctaaattatagg |
6809224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 6817318 - 6817357
Alignment:
| Q |
183 |
acatgacaaattgctagtttgtgaaaatttctaaattata |
222 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
6817318 |
acatgacaaattgctagtttgtgaagatttctaaactata |
6817357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University