View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_high_111 (Length: 237)
Name: NF1614_high_111
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_high_111 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 50105062 - 50105282
Alignment:
| Q |
18 |
tatctgactctacttttataatctccactcttt-gaactgatgcttagcaaaaggaaaaagtcccctgctgctgaccaagatagaaacagaggatcggaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50105062 |
tatctgactctacttttataatctccactcttttgaactgatgcttagcaaaaggaaaaagtcccctgctgctgaccaagatagaaacagaggatcggaa |
50105161 |
T |
 |
| Q |
117 |
gatgactccgacatagatgtttctgcagacagtgatgattctaaaagggatacgcaacctatatccgagagtgatgatgctggttatgaaattgagaatc |
216 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50105162 |
gatgacttcgacatagatgtttctgcagacagtgatgattctaaaagggatacgcaacctatatccgagagtgatgatgctggttatgaaattgagaatc |
50105261 |
T |
 |
| Q |
217 |
acagcagtagtgaggagaatg |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
50105262 |
acagcagtagtgaggagaatg |
50105282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University