View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_high_34 (Length: 411)
Name: NF1614_high_34
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_high_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 11 - 331
Target Start/End: Original strand, 43323364 - 43323713
Alignment:
| Q |
11 |
agatgaatatttattattgtgatgcaactgggagcaacccgtgctaggttgaattgttctcttatgaaaggctcttgagaggtactgcctctagtgatga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||||||||||| |||||||| |
|
|
| T |
43323364 |
agatgaatatttattattgtgatgcaactgggagcaacccgtgctaggttgaattgttcccttatgtaaggctgttgagaggtactgcctccagtgatga |
43323463 |
T |
|
| Q |
111 |
gtatgtata------------attagattcgaacacacactctgacacacataacgctcatccgtaagatgtagaagagcttcaaccctagtttctctct |
198 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43323464 |
gtatgtatatcaagtcatcccattagatttgaacacacactctgacaaacataacgctcatccgtaagatgtagaagagcttcaaccctagtttctctct |
43323563 |
T |
|
| Q |
199 |
catgttctatgaaggttaagatttctcaattgcatcaaatagataatttgatttatacaacacaatttattgttttacaataatattacgcgat------ |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43323564 |
catgttctatgaaggttaagatttctcaattgcttcaaatagatcatttgatttatacaacacaatttattgttttacaataatattacgcgatataact |
43323663 |
T |
|
| Q |
293 |
-----------tttggtcacaaacaatccagcatgagatcgtagtatcaa |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43323664 |
ctatatctgattttggtcacaaacaatccagcatgagatcgtagtatcaa |
43323713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 325 - 396
Target Start/End: Original strand, 43325426 - 43325497
Alignment:
| Q |
325 |
gtatcaacctaggtaatgatcaatggcaatggttaatacgcataaattgcacatcgaacaagggttgtttct |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43325426 |
gtatcaacctaggtaatgatcaatggcaatggttaatacgcataaattgcacatcgaacaagggttgtttct |
43325497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University