View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_high_59 (Length: 330)
Name: NF1614_high_59
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_high_59 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 132 - 330
Target Start/End: Original strand, 21148452 - 21148650
Alignment:
| Q |
132 |
gcaattgcgtcctgatgcgggtgcggacattgtcaaacccacactattgtggccaatcgcattatgtggtccgcaatttgaaactacggattgtagtgca |
231 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21148452 |
gcaattgcggcctgatgcgggtgcggacattgtcaaacccacactattgtggccgatcgtgttatgtggtccgcaatttgaaactacggattgtagtgca |
21148551 |
T |
 |
| Q |
232 |
ttgcgaatgttggactctcaaggtttgtcaatcctcaaggattgatccccatgtgaggaatgtttctttgtataccttatttttattataatttgattc |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
21148552 |
ttgcgaatgttggactctcaaggtttgtcaatcctcaaggattgatccccatgtgaggaatgttgctttgtataccttattttcattataatttgattc |
21148650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 19 - 133
Target Start/End: Original strand, 21148193 - 21148307
Alignment:
| Q |
19 |
gctacttgttctgattannnnnnnctgctctctttgcttcattttgtctctatttagtttgtctaatatatccgttttttactcattctgataaaatttc |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21148193 |
gctacttgttctgattatttttttctgctctctttgcttcattttgtctctatttagtttgtctaatatatccgttttatactcattctgataaaatttc |
21148292 |
T |
 |
| Q |
119 |
tttaccgaactatgc |
133 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
21148293 |
tttaccgaactatgc |
21148307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University