View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_high_63 (Length: 320)
Name: NF1614_high_63
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_high_63 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 177 - 303
Target Start/End: Complemental strand, 32073709 - 32073583
Alignment:
| Q |
177 |
ttattctccttgtcttgattttattaactttaatttctctcatgcaacaaaacttatgccatgtgcattcctcgaatttacacatcctagttaaaattga |
276 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
32073709 |
ttattctccttgccttgattttattaactttaatttctcttatgcaacaaaacttatgccatgtgcattgctcgaatttacacatcctagtcaaaattga |
32073610 |
T |
|
| Q |
277 |
taattctaagtaaattttttacaattc |
303 |
Q |
| |
|
| ||||||||||| |||||||||| |
|
|
| T |
32073609 |
aatttctaagtaaaaaatttacaattc |
32073583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 6 - 158
Target Start/End: Complemental strand, 32073855 - 32073698
Alignment:
| Q |
6 |
gtaactagagaatgcttatagctacctaa-------ttatgggactggctatattgttcaaatatcttgaaatcaaagtaggaagtcgtaggaagtggac |
98 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| | ||| ||||||||| |
|
|
| T |
32073855 |
gtaactagagaatgcttatagctacctaagtatgatttatgggactggctatattgttcaaatatcttgaaatc-aagtaggaatttgtatgaagtggac |
32073757 |
T |
|
| Q |
99 |
taagttaccaaacattgaaagagaagtgaatcgaaaataaaaaactaattattctccttg |
158 |
Q |
| |
|
|||||||||||||| | |||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
32073756 |
taagttaccaaacactaaaagagaagtgaatcgggaa-aaaaaactaattattctccttg |
32073698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University