View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_high_65 (Length: 318)
Name: NF1614_high_65
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_high_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 19 - 308
Target Start/End: Complemental strand, 48501671 - 48501382
Alignment:
| Q |
19 |
ttagtaaccttcatggtattcttacaaggcttccatccattcaacactcaaaaacctctttggatttccgagaaatgcacactctcttcagaaaacccta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48501671 |
ttagtaaccttcatggtattcttacaaggcttccatccattcaacactcaaaaacctctttggatttccgagaaatgcacactctcttcagaaaacccta |
48501572 |
T |
 |
| Q |
119 |
atttcctcccactccttctccaactcctccaagaaatcatatccaactcacccacagcgcacgatagcacttgccctagatcccagcttcaaaaactcaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48501571 |
atttcctcccactccttctccaactcctccaagaaatcatatccaactcacccacagcgcacgatagcacttgccctagatcccagcttcaaaaactcaa |
48501472 |
T |
 |
| Q |
219 |
accagagcccattgcatggatcatagactcgcacacaccagaatctctctccattttcttcaaccttgttttcaccattcgtctcctttg |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48501471 |
accagagcccattgcatggatcatagactcgcacacaccagaatctctctccattttcttcaaccttgttttcaccattcgtctcttttg |
48501382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University