View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_high_74 (Length: 295)
Name: NF1614_high_74
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_high_74 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 28309763 - 28310046
Alignment:
| Q |
1 |
ctttctttccagtttgcattcattccagttgaatcttcatcttcctcttctcaaacaatgtctgctcctcacggtggctcccttcctccgtcttcctcgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |||||||||| |
|
|
| T |
28309763 |
ctttctttccagtttgcattcattccagttgaatcttcatcttcctcttctcaaacaatgtctactcctcaccatggctcccttcctccttcttcctcgg |
28309862 |
T |
|
| Q |
101 |
ctcctatcatagtggctacggctgggtggatgctgaagctcagcctgtctcttgtggccacaacaacactgctagcattttcactagcaatattctcctc |
200 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28309863 |
ctcctatcacagtggctacggccgggtggatgttgaagctcagcctgtctcttatggccacaacaacactgctagcattttcactagcaatattctcctc |
28309962 |
T |
|
| Q |
201 |
ctcccttgtaaacacatgttgcaaaaaccaaattgtgggactcacgattttctcgaacttttcattctttgcaagtatcttcat |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28309963 |
ctcccttgtaaacacatgttgcaaaaaccaaattgtgggactcacgattttctcgaacttttcattctttgcaagtatcttcat |
28310046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University