View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_high_92 (Length: 250)
Name: NF1614_high_92
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_high_92 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 8 - 250
Target Start/End: Complemental strand, 4810774 - 4810532
Alignment:
| Q |
8 |
acataatactaatattttattattggtttgaagttggttaaagttaagctaaggtcgttttgctttgaattaaaccaatggtgcactcatctgtttgggt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
4810774 |
acataatactaatattttattattggtttgaagttggttaaagttaagctaaggtcgttttgctttgaattaaaccaatggcgcactcatctttttgggt |
4810675 |
T |
|
| Q |
108 |
ttttcgtgttaggggattgtatgacatttgatgatgttgagggtgaagttgtggttttttcttatcggatgctaaaatttaccccttggcgtattttctt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4810674 |
ttttcgtgttaggggattgtatgacatttgatgatgttgagggtgaagttgtggttttttcttatcggatgctaaaatttaccccttggcgtattttctt |
4810575 |
T |
|
| Q |
208 |
gttactgaatttagtagagtaaatattgattgagatataaaaa |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4810574 |
gttactgaatttagtagagtaaatattgattgagatataaaaa |
4810532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 13 - 63
Target Start/End: Complemental strand, 4820720 - 4820670
Alignment:
| Q |
13 |
atactaatattttattattggtttgaagttggttaaagttaagctaaggtc |
63 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||| |||| |
|
|
| T |
4820720 |
atactaatattttagtattggtttggagttggttaaagttaagctatggtc |
4820670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University