View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_high_96 (Length: 249)
Name: NF1614_high_96
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_high_96 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 45603952 - 45603720
Alignment:
| Q |
1 |
tgttattcatgggatattattgatgtgcttggcctgcatgggaagggaattcagtgggccactacatatattttactagtttccaaaatcaaagttgtaa |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45603952 |
tgttattcctgggatattattgatgtgcttggcctgcatgggaagggaattcaatgggccactacatatattt-actagtttccaaaatcaaagttgtaa |
45603854 |
T |
 |
| Q |
101 |
ctagtggggcatgaaatccatccatccataattgaagcttcatcatcctgaaataatatagtcatctgtgaggactaaaccagcccctagaagagcaata |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45603853 |
ctagtggggcatgaaatccatccat----aattgaagcttcatcatcctgaaataatatagtcatctgtgaggactaaaccagcccctagaagagcaata |
45603758 |
T |
 |
| Q |
201 |
gatgtaatgaccatgatcaaaattggtgtccatttcat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45603757 |
gatgtaatgaccatgatcaaaattggtgtccatttcat |
45603720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 47711795 - 47711712
Alignment:
| Q |
155 |
aatatagtcatctgtgaggactaaaccagcccctagaagagcaatagatgtaatgaccatgatcaaaattggtgtccatttcat |
238 |
Q |
| |
|
||||||||||||| ||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47711795 |
aatatagtcatctctgataactaagccagcccctagaagagcaatagaagtaatgaccatgatcaaaattggtgtccatttcat |
47711712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University