View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_high_97 (Length: 249)
Name: NF1614_high_97
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_high_97 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 50105641 - 50105405
Alignment:
| Q |
13 |
aatatgtagaagcttaagaagagggatgttttcaaaataaccccaaattttgctgactacattctacactgctagatacttccccaaaatgtaagttaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50105641 |
aatatgtagaagcttaagaagagggatgttttcaaaataaccccaaattttgctgactacattctacactgctagatacttccccaaaatgtaagttaaa |
50105542 |
T |
|
| Q |
113 |
tactgggcctaggtagcctaagaaagatctgtcttcccttcatccgattcatcctctgaatcaggaacaacagtagattctatggcagtattccgggtag |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50105541 |
tactgggcctaggtagactaagaaagatctgtcttcccttcatccgattcatcctctgaatcaggaacaacagtagattctatggcagtatttcgggtag |
50105442 |
T |
|
| Q |
213 |
gtctctgtctcactctttgctttgcagtcaaacccat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50105441 |
gtctctgtctcactctttgctttgcagtcaaacccat |
50105405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University