View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_low_115 (Length: 239)
Name: NF1614_low_115
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_low_115 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 32447495 - 32447431
Alignment:
| Q |
18 |
actcatttcaagaaaaagaacaaaaaccccactgatgctgctgaaaaggcgaaaaaccgttattt |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32447495 |
actcatttcaagaaaaagaacaaaaaccccactgatgctgctgaaaaggcgaaaaaccgttattt |
32447431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 32447353 - 32447289
Alignment:
| Q |
160 |
tggacatgaaagggatcatagacttgttgcttgaggaaaatgagtactgtactagtgtaccttct |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32447353 |
tggacatgaaagggatcatagacttgttgcttgaggaaaatgactactgtactagtgtaccttct |
32447289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University