View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_low_122 (Length: 236)
Name: NF1614_low_122
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_low_122 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 39517817 - 39518037
Alignment:
| Q |
1 |
tactattgaaatgtgactcctaagaccttcgtgtaacttaatactatttgagtggatctgtattgttgcggtaattattagtttagaaattccacctgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39517817 |
tactattgaaatgtgactcctaagaccttcgtgtaacttaatactatttgagtggatctgtattgttgcggtaactattagtttagaaattccacctgca |
39517916 |
T |
 |
| Q |
101 |
ttgaatcgggcttcctaaaattgattattccttcttatcaatatcatgcaataaaaatctaatgtcatgaaaacctacatagatgctttgtcattttcat |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39517917 |
atgaatcgggcttccgaaaattgattattccttcttatcaatatcatgtaataaaaatctaatgtcatgaaaacctacatagatgctttgtcattttcat |
39518016 |
T |
 |
| Q |
201 |
agcagtatgggggcaattact |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39518017 |
agcagtatgggggcaattact |
39518037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University