View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_low_131 (Length: 225)
Name: NF1614_low_131
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_low_131 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 710575 - 710779
Alignment:
| Q |
1 |
atcacgctacaaatccacatcccagcacatcaaat---gtttctgcaaacttataccatttgcatttgcatgactctcgttttgatgtttctataatact |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
710575 |
atcacgctacaaatccacatcccagcacatcaaataatgtctctgcaaacttataccatttgcacttgcatgactctcgttttgatgtttctataatact |
710674 |
T |
|
| Q |
98 |
cacagatgaaactatacacatattttattttattttggtttggagattcaactttttctagtaaaagtattgtgataagtttattaattatatgaaatgt |
197 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
710675 |
cccagatgaaactatacacatattttattttattttggtttggagattcaactttttctagtaaaagtattgtgataagtttattaattatatgaaatgt |
710774 |
T |
|
| Q |
198 |
aatga |
202 |
Q |
| |
|
||||| |
|
|
| T |
710775 |
aatga |
710779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University