View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_low_132 (Length: 221)
Name: NF1614_low_132
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_low_132 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 43952849 - 43953055
Alignment:
| Q |
1 |
aaaccatgatgatcacaaccatcacactcttcctgagaattgtgttgcactgttatcatattctccgagtccttacgatgatttcaggcgatcaatgcaa |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
43952849 |
aaaccatgatgatcacaatcatcacactcttcctgagaattgtgttgcactgttatcatattctccaagtccttacgatgatttcaggcgatcgatgcaa |
43952948 |
T |
|
| Q |
101 |
gaattggtggaatcaaagtatggtaagattgaaaacaatcaaaggaaaattgattgggacttcatggaggagattttattttgttatcttaatgttaatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43952949 |
gaattggtggaatcaaagtatggtaagattgaaaacaatcaaaggaaaattgattgggacttcatggaggagattttattttgttatcttaatgttaatg |
43953048 |
T |
|
| Q |
201 |
agaaaaa |
207 |
Q |
| |
|
||||||| |
|
|
| T |
43953049 |
agaaaaa |
43953055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University