View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_low_44 (Length: 380)
Name: NF1614_low_44
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 151 - 370
Target Start/End: Complemental strand, 481230 - 481011
Alignment:
| Q |
151 |
atcaggatggtgggtgctcttgccagtaaagagcatgatttccaccaagtacagcaaatatattaggacagcttgatcctagtttagataaatctcctct |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
481230 |
atcaggatggtgggtgctcttgccagtaaagagcatgatttccaccaagtacaacaaatatattaggacagcttgatcctagtttagataaatctcctct |
481131 |
T |
 |
| Q |
251 |
tcatcacgctcctgcttagctccaattgacgcatgcagacatcttcgagctctctaaccaggtagatgaaccgtgcttgagcctcgtttatgacatctac |
350 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
481130 |
tcatcacgctcctggttaactccaattgacgcatgcagacatcttcgagctctctaaccaggtaggtgaaccgtgcttgagcctcgtttatgacatctac |
481031 |
T |
 |
| Q |
351 |
ctcctagttagcctcctttg |
370 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
481030 |
ctcctagttagcctcctttg |
481011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 19 - 104
Target Start/End: Complemental strand, 481315 - 481230
Alignment:
| Q |
19 |
ctagccagacagattcctggtcttgtgaatgcatgaaacgttaaactcgatgcataagtgagtcaagacggtcgatacccatgcaa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
481315 |
ctagccagacagattcctggtcttgtgaatgcatgaaacgttaaactcgatgcataagtgagtcaggacggtcgatacccatgcaa |
481230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University