View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_low_60 (Length: 333)
Name: NF1614_low_60
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_low_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 318
Target Start/End: Original strand, 46126711 - 46127016
Alignment:
| Q |
18 |
tgtaaatttgcgatt-tttcgctcgaatattattttattctcttcgcatttcttttctccaatatcctcggaaaaagaatcaaacatcactgttctctct |
116 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46126711 |
tgtaaatttgcgattgtttcactcgaatattattttattctcttcgcatttcttttctccaatatcctcggaaaaagaatcaaacatcactgttctctct |
46126810 |
T |
 |
| Q |
117 |
ctaccactatctaaggcatgtttaagcaaggaatccagttattatta----nnnnnnnnnnnnnnngcagttttgaatttcgatgatattatccattttt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
46126811 |
ctaccactatctaaggcatgtttaagcaaggaatccagttattattattttttttaatttttttttgcaattttgaatttcgatgatattatccattttt |
46126910 |
T |
 |
| Q |
213 |
tacaactgtatatatttgcaattaaacccttatgttttaattttattcgtttctaatgttattgctgtatttgattcaggtttaattcgatgttacatga |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46126911 |
tacaactgtatatatttgcaattaaacccttctgttttgattttattcgtttctaatgttattgctgtatttgattcaggtttaattcgatgttacatga |
46127010 |
T |
 |
| Q |
313 |
tcttat |
318 |
Q |
| |
|
|||||| |
|
|
| T |
46127011 |
tcttat |
46127016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University