View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_low_70 (Length: 314)
Name: NF1614_low_70
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_low_70 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 12 - 298
Target Start/End: Original strand, 32223964 - 32224250
Alignment:
| Q |
12 |
aaagggagaggattgaatacagattgcacaaatgtcataaaaatgtttcactgttttcacaaaaatccttgttgttgctaaaaatagaacaaaaaacaga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32223964 |
aaagggagaggattgaatacagattgcacaaatgtcataaaaatgtttcactgttttcacaaaaatccttgttgttgctaaaaatagaacaaaaaacaga |
32224063 |
T |
|
| Q |
112 |
atcatccatccactactcaactttcacttcttccactcaactagttacaccattgatctgttttattaacaccaaacccaaaacccatttcgtgattgcc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224064 |
atcatccatccactactcaactttcacttcttccactcaactagttacaccattgatctgttttattaacaccaaacccaaaacccatttcgtgattgcc |
32224163 |
T |
|
| Q |
212 |
gagcgtcgttcatattatctgcacaaacactcagaaccaaagagagagaaagagaaagtagatagatagcaatgatgatggatgagg |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224164 |
gagcgtcgttcatattatctgcacaaacactcagaaccaaagagagagaaagagaaagtagatagatagcaatgatgatggatgagg |
32224250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University