View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_low_75 (Length: 304)
Name: NF1614_low_75
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_low_75 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 8e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 104 - 295
Target Start/End: Original strand, 43095733 - 43095925
Alignment:
| Q |
104 |
gataaatgggaatgaacattgttaacattagaggaatttaatcatttaatatactttttattgaggaaatgaataaaaaattaaaactatagggaataac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43095733 |
gataaatgggaatgaacattgttaacattagaggaatttaatcatttaatatactttttattgaggaaatgaataaaaaattaaaactatagggaataac |
43095832 |
T |
 |
| Q |
204 |
atgcttaca-agtagtacagaagatttgcttcacgaacttatgtggtttttattcaaacagaattgcttaaattgtttgcatttgtttcatct |
295 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43095833 |
atgcttacagagtagtacagaagatttgcttcacgaacttatgtggtttttatgcaaacagaattgcttaaattgtttgcatttgtttcatct |
43095925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 17 - 87
Target Start/End: Original strand, 43095623 - 43095693
Alignment:
| Q |
17 |
agattgaccttctagctggttcagaacaacttgcctcaggtgttttgtgtgaattgtttctatgaacattg |
87 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43095623 |
agattggccttctagctggttcagaacaacttacctcaggtgttttgtgtgaattgtttctatgaacattg |
43095693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University