View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_low_79 (Length: 288)
Name: NF1614_low_79
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_low_79 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 46922186 - 46921971
Alignment:
| Q |
1 |
aattcagaaaagggcttgtttttattttcaacaatagtatcaaatttaccctccttttgtttttgtacaccaagaaattgtagcttctgctcaagcttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46922186 |
aattcagaaaagggcttgtttttattttcaacaatagtatcaaatttaccctccttttgtttttgtacaccaagaaattgtagcttctgctcaagcttct |
46922087 |
T |
|
| Q |
101 |
taacaaagttaatagcacccccaataattgatgcttgatcaccctgcaaaattcatcaatcaaaacacaaaagtaaaaatgtgatcctaaccgcaattta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46922086 |
taacaaagttaatagcacccccaataattgatgcttgatcaccctgcaaaattcatcaatcaaaacacaaaagtaaaaatgtgatcctaacagcaattta |
46921987 |
T |
|
| Q |
201 |
aaactaaatatttttc |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
46921986 |
aaactaaatatttttc |
46921971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 271
Target Start/End: Complemental strand, 46921945 - 46921898
Alignment:
| Q |
224 |
ctatagaagtaccctttggacgtaggattcaggcatgagagatctaag |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46921945 |
ctatagaagtaccctttggacgtaggattcaggcatgagagatctaag |
46921898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 68 - 148
Target Start/End: Original strand, 36676080 - 36676160
Alignment:
| Q |
68 |
caccaagaaattgtagcttctgctcaagcttcttaacaaagttaatagcacccccaataattgatgcttgatcaccctgca |
148 |
Q |
| |
|
|||||||||| || | ||| |||||||||| ||||||||||||||||| || ||||| || || |||||||||||||||| |
|
|
| T |
36676080 |
caccaagaaaatgaaacttgtgctcaagctctttaacaaagttaatagctcctccaattatagaagcttgatcaccctgca |
36676160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University