View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_low_86 (Length: 279)
Name: NF1614_low_86
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_low_86 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 96 - 264
Target Start/End: Original strand, 6938077 - 6938245
Alignment:
| Q |
96 |
cttgagtgaaggtggaagattataagtcacaagataaaaatggcaatttattatattgtttatgttttgtagattagaatgaaaatgaaatggaaaaggt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6938077 |
cttgagtgaaggtggaagattataagtcacaagataaaaatggcaatttattatattgtttatgttttgtagattagaatgaaaatgaaatggaaaaggt |
6938176 |
T |
 |
| Q |
196 |
gaagtatatgaaagtgaagagcatttatttatttatgtagcaaataatatacacttcatatagtaattt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6938177 |
gaagtatatgaaagtgaagagcatttatttatttatgtagcaaataatatacacttcatatagtaattt |
6938245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University