View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1614_low_93 (Length: 262)
Name: NF1614_low_93
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1614_low_93 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 11 - 132
Target Start/End: Complemental strand, 25253965 - 25253844
Alignment:
| Q |
11 |
agaaaattgatattattacctcttcgttctttcacctaaaaccttagtcgcccttttaggttgattatcttcttgtccattcttctgattctattgttca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25253965 |
agaaaattgatattattacctcttcgttctttcacctaaaaccttagtctcccttttaggttgattatcttcttgtccattcttctgattctattgttca |
25253866 |
T |
 |
| Q |
111 |
aactatcatacctgataatagc |
132 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
25253865 |
aactatcatacctgataatagc |
25253844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 125 - 248
Target Start/End: Complemental strand, 25252874 - 25252751
Alignment:
| Q |
125 |
ataatagcataatctattgctataaactagaaataatgacatttatttacttgtcaacatttgatgttgttgatttctacatgtgggaatgctcgctgat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25252874 |
ataatagcataatctattgctataaactagaaatcatgacatttatttacttgtcaacatttgatgttgttgatttctacatgtgggaatgctagctgat |
25252775 |
T |
 |
| Q |
225 |
attaaacattttaaccatatttct |
248 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
25252774 |
attaaacattttaaccatatttct |
25252751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University