View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16150_high_5 (Length: 333)
Name: NF16150_high_5
Description: NF16150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16150_high_5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 15 - 333
Target Start/End: Complemental strand, 4933742 - 4933423
Alignment:
| Q |
15 |
tatgtatcaattgtcataattgttaaaaa-tgacacttattttaaaacagaaaatatcatacctcagctatgatggttatgtcaagttttgtggttccaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4933742 |
tatgtatcaattgtcataattgttaaaaaatgacacttattttaaaacagaaaatatcatacctcagctatgatggttatgtcaagttttgtggttccaa |
4933643 |
T |
 |
| Q |
114 |
atagcaatgcactactactagtgactgatagatgaagattctctatctcttggattatgttcatcaatgcacccttatgtttctcacaatggacacgaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4933642 |
atagcaatgcactactactagtgactgatagatgaagattctctatctcttggattatgttcatcaatgcacccttatgtttctcacaatggacacgaat |
4933543 |
T |
 |
| Q |
214 |
cagcacgtttttctctgacactcttgcctcaacttcaggcagtgacctacttggttttgaggtttgagtgtgacaacaattaccatagccagaatttgat |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4933542 |
cagcacgtttttctctgacactcttgcctcaacttcaggcagtgacctacttggttttgaggtgtgagtgtgacaacaattaccatagccagaatttgat |
4933443 |
T |
 |
| Q |
314 |
gaggtgtctgaaacatcttc |
333 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
4933442 |
gaggtttctgaaacatcttc |
4933423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University