View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16151_high_12 (Length: 320)
Name: NF16151_high_12
Description: NF16151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16151_high_12 |
 | |
|
| [»] scaffold0147 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0147 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 11 - 268
Target Start/End: Original strand, 16258 - 16515
Alignment:
| Q |
11 |
cacagaggaaatccataaagatgctaaacagtcattatttcttaataagtactggaaaaccgttatgttttagagatgtgcaattcaatgaagtagtgga |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16258 |
cacacaggaaatccataaagatgctaaacagtcattatttcttaataagtactggaaaaccgtaatgttttagagatgtgcaattcaatgaagtagtgga |
16357 |
T |
|
| Q |
111 |
tcctccgagaggtttaactctcactgtatgcagcatcaaacatcttaatcgagactatagggttatttgaaagtaccgccagtttagtctttgagattgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16358 |
tcctccgagaggtttaactctcactgtatgcagcatcaaacatcttaatcgagactatagggttatttgaaagtaccgccagtttagtctttgagattgt |
16457 |
T |
|
| Q |
211 |
acacataacacgatttggtcattgtagcgaaacttcaaaatgatcttaaaataaaatg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16458 |
acacataacacgatttggtcattgtagcgaaatttcaaaatgatcttaaaataaaatg |
16515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University