View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16151_high_16 (Length: 297)
Name: NF16151_high_16
Description: NF16151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16151_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 14 - 280
Target Start/End: Original strand, 50490323 - 50490589
Alignment:
| Q |
14 |
gaacaataatcagcatgaattaggctatttcaatgtcctcattcttgacttattttgcaaaactttggtttgaaatcacaaggatttgaaaggctgtacc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50490323 |
gaacaataatcagcatgaattaggctatttcaatgtcctcattcttaacttattttgcaaaactttggtttgaaatcacaaggatttgaaaggctgtacc |
50490422 |
T |
|
| Q |
114 |
tgttcaatattgacagtgaacggtcctttcgattgacactcaggacaggaaccaactttcacctctgaataggaattctgaaaaaagggtcccaaaactg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50490423 |
tgttcaatattgacagtgaacggtcctttcgattgacactcaggacaggaaccaactttcacctctgaataggaattctgaaaaaagggtcccaaaactg |
50490522 |
T |
|
| Q |
214 |
ccccacatttgccacagtcatacttcacctattgcaactgggggaaaactccggagcgcctggttac |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50490523 |
ccccacatttgccacagtcatacttcacctgttgcaactgggggaaaactccggaacgcctggttac |
50490589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University