View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16151_low_21 (Length: 252)
Name: NF16151_low_21
Description: NF16151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16151_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 66 - 241
Target Start/End: Complemental strand, 5256352 - 5256177
Alignment:
| Q |
66 |
ttattgatattgaaacatctatcacctaatgtaattgatgaatactatttagcaaatgaattgttcccagtaaaaagaaaacactataggaaaatagctt |
165 |
Q |
| |
|
|||||||| |||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5256352 |
ttattgattttgaaacatctagcacataatgtaattgatgaatactatttagcaaatgaattgttcccagtaaaaacaaaacactataggaaaatagctt |
5256253 |
T |
|
| Q |
166 |
catatcgatattgtgttcattgtaaaaacaaagagtgcaaaatgattgttaaattcatttagtttcgatcccctat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5256252 |
catatcgatattgtgttcattgtaaaaacaaagagcgcaaaatgattgttaaattcattgagtttcgatcccctat |
5256177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 5256409 - 5256373
Alignment:
| Q |
19 |
aagttcctatattgaagatgatataaggtatatagta |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5256409 |
aagttcctatattgaagatgatataaggtatatagta |
5256373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 147
Target Start/End: Complemental strand, 5256075 - 5256045
Alignment:
| Q |
117 |
gcaaatgaattgttcccagtaaaaagaaaac |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5256075 |
gcaaatgaattgttcccagtaaaaagaaaac |
5256045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University